|
Bioedit Company
sequence alignment editor v7 0 5 3 Sequence Alignment Editor V7 0 5 3, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence alignment editor v7 0 5 3/product/Bioedit Company Average 86 stars, based on 1 article reviews
sequence alignment editor v7 0 5 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Ebiogen Inc
quantseq 3 mrna sequencing Quantseq 3 Mrna Sequencing, supplied by Ebiogen Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quantseq 3 mrna sequencing/product/Ebiogen Inc Average 86 stars, based on 1 article reviews
quantseq 3 mrna sequencing - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 Primer Cd44 R Sequence 5 Cattgtgggcaaggtgctatt 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 Primer Krt15 R Sequence 5 Ccagggcacgtaccttgtc 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 r sequence 5 ccagggcacgtaccttgtc 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 Primer Cd44 F Sequence 5 Ctgccgctttgcaggtgta 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 f sequence 5 ctgccgctttgcaggtgta 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 Primer Krt15 F Sequence 5 Tctgctaggtttgtctcttcagg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 Primer β Actin R Sequence 5 Gtagtttcgtggatgccaca 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin r sequence 5 gtagtttcgtggatgccaca 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer β actin f sequence 5 tccctggagaagagctacg 3 Primer β Actin F Sequence 5 Tccctggagaagagctacg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin f sequence 5 tccctggagaagagctacg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin f sequence 5 tccctggagaagagctacg 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
10X Genomics
v 3 rna sequence platform V 3 Rna Sequence Platform, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/v 3 rna sequence platform/product/10X Genomics Average 86 stars, based on 1 article reviews
v 3 rna sequence platform - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Novogene
mrna sequencing 3 seq ![]() Mrna Sequencing 3 Seq, supplied by Novogene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mrna sequencing 3 seq/product/Novogene Average 86 stars, based on 1 article reviews
mrna sequencing 3 seq - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
Journal: Nucleic Acids Research
Article Title: Alternative polyadenylation links RNA processing to iron metabolism in human erythropoiesis
doi: 10.1093/nar/gkag218
Figure Lengend Snippet: Single-cell atlas of PAS dynamics during human myelopoiesis and erythropoiesis. (A-B) Unsupervised transcriptional trajectory of myelopoiesis, including erythropoiesis, from Monocle 2, colored by cell states (A) and eight cell clusters (B) , which were clustered and defined based on lineage-specific markers expression . HSC, hematopoietic stem cells; G./M., granulocyte or monocyte lineage; Ery., erythrocyte lineage. (C) The top-scoring polyadenylation (PA) signals were identified through de novo motif analysis of all 14 510 PAS peaks across 15 606 cells in myelopoiesis. The sequences analyzed spanned from 30 nt upstream to 120 nt downstream of the peak’s 3′-end. Statistical significance was assessed using Fisher ’ s exact test. (D) Schematic representation of the proximal PAS usage index ( pPUI ). In 3′tag scRNA-seq data, reads from different RNA molecules of the same transcript isoform accumulate at distinct peaks, which can be used to infer PAS locations and assess their usage. The arrows indicate PASs classified as proximal (Prox.), middle (Mid.), or distal (Dist.) based on their distance from the 5′end of the 3′UTR. The pPUI , defined by scAPA , quantifies the relative usage of the most proximal PAS within a 3′UTR containing two or more peaks. C1, the read count of the most proximal peak;
Article Snippet: RNA sequencing (RNA-seq) and
Techniques: Single Cell, Expressing, Standard Deviation
Journal: Nucleic Acids Research
Article Title: Alternative polyadenylation links RNA processing to iron metabolism in human erythropoiesis
doi: 10.1093/nar/gkag218
Figure Lengend Snippet: CPSF6 knockdown alters 3′UTR-APA. (A) Schematic diagram of experimental design. Human UCB-derived CD34 + HSPCs were induced to erythroid cells in vitro , and infected with shRNA lentivirus to knock down CPSF6. Cells on day 11 (D11) and 13 (D13) were subjected to bulk RNA-seq and 3′-seq. Schematic read distributions from 3′-seq and RNA-seq illustrating 3′UTR APA changes are shown on the right. (B) Cumulative distribution of the pPUI in differentiated cells with control and CPSF6 knockdown. Every shCPSF6 sample was compared to its control by the Kruskal–Wallis test, and the P values were all less than 2.2e-16. The pie chart shows the number and proportion of differentially shortening and lengthening APA-genes. (C) Volcano plot of differential APA-genes of CPSF6 knockdown samples compared to control samples identified by bulk RNA-seq at D11. (D) Venn diagram showing genes with differential APA identified in normal erythropoiesis (scRNA-seq) and in CPSF6 knockdown cells (bulk RNA-seq and 3′-seq at days 11 and 13). See . ( E and F ) Genome browser tracks of 3′-seq and RT-qPCR validation of representative iron metabolism-related differential APA genes after CPSF6 knockdown. (G) GSEA plot of APA-gene pPUI in 3′-seq datasets on day 11.
Article Snippet: RNA sequencing (RNA-seq) and
Techniques: Knockdown, Derivative Assay, In Vitro, Infection, shRNA, RNA Sequencing, Control, Quantitative RT-PCR, Biomarker Discovery